Stem-loop sequence hsa-mir-6740

AccessionMI0022585 (change log)
Symbol HGNC:MIR6740
DescriptionHomo sapiens miR-6740 stem-loop
Stem-loop
   gaaaga        u          gaa   ---u   g       --ga     --    a 
5'       guuuggga ggagagagga   acu    gag ucucugg    guugc  uuaa c
         |||||||| ||||||||||   |||    ||| |||||||    |||||  |||| c
3'       caaacccu ccucucuucu   uga    cuu agagacc    caaug  aguu a
   ----ga        -          --g   uagu   a       gguc     cc    g 
Get sequence
Deep sequencing
185 reads, 4.11 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 202003124-202003236 [+]
intergenic
Database links

Mature sequence hsa-miR-6740-5p

Accession MIMAT0027381
Sequence

6 - 

aguuugggauggagagaggaga

 - 27

Get sequence
Deep sequencing92 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6740-3p

Accession MIMAT0027382
Sequence

92 - 

ugucuucucuccucccaaacag

 - 113

Get sequence
Deep sequencing57 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).