Stem-loop sequence hsa-mir-6739

AccessionMI0022584 (change log)
Symbol HGNC:MIR6739
DescriptionHomo sapiens miR-6739 stem-loop
Literature search

1 open access papers mention hsa-mir-6739
(1 sentences)

Stem-loop
   gaaug     a     a       ---guaaaa    uuu 
5'      uggga agaga agaacaa         ggaa   u
        ||||| ||||| |||||||         ||||    
3'      acccu uuucu ucuuguu         ccuu   c
   ----g     c     g       aauccccga    uua 
Get sequence
Deep sequencing
76 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 201863373-201863447 [+]
sense
OTTHUMT00000087099 ; RP11-307B6.3-001; intron 1
ENST00000414927 ; RP11-307B6.3-001; intron 1
Database links

Mature sequence hsa-miR-6739-5p

Accession MIMAT0027379
Sequence

6 - 

ugggaaagagaaagaacaagua

 - 27

Get sequence
Deep sequencing39 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6739-3p

Accession MIMAT0027380
Sequence

55 - 

auuguucugucuuucucccag

 - 75

Get sequence
Deep sequencing35 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).