Stem-loop sequence hsa-mir-6738

AccessionMI0022583 (change log)
Symbol HGNC:MIR6738
DescriptionHomo sapiens miR-6738 stem-loop
Stem-loop
   gaaggc a         - --a   c       cu 
5'       g gggguagaa g   gca agggguu  g
         | ||||||||| |   ||| |||||||   
3'       c ccucaucuu c   cgu uucccaa  a
   ----ga -         a guc   c       au 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 155951273-155951336 [-]
sense
OTTHUMT00000046217 ; ARHGEF2-014; intron 2
OTTHUMT00000046208 ; ARHGEF2-005; intron 4
OTTHUMT00000046207 ; ARHGEF2-004; intron 5
ENST00000477754 ; ARHGEF2-014; intron 2
ENST00000495070 ; ARHGEF2-005; intron 4
ENST00000462460 ; ARHGEF2-004; intron 5
ENST00000368316 ; ARHGEF2-202; intron 5
antisense
OTTHUMT00000473130 ; RP11-336K24.12-001; exon 2
ENST00000610146 ; RP11-336K24.12-001; exon 2
Database links

Mature sequence hsa-miR-6738-5p

Accession MIMAT0027377
Sequence

6 - 

cgagggguagaagagcacagggg

 - 28

Get sequence
Deep sequencing29 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6738-3p

Accession MIMAT0027378
Sequence

41 - 

cuucugccugcauucuacucccag

 - 64

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).