Stem-loop sequence hsa-mir-6737

AccessionMI0022582 (change log)
Symbol HGNC:MIR6737
DescriptionHomo sapiens miR-6737 stem-loop
Stem-loop
   u     u       uc   c u        -uuu u 
5'  ugggu ggggugg  ggc c ggaggggg    g u
    ||||| |||||||  ||| | ||||||||    |  
3'  accca ccccacu  ucg g ucuccccu    c u
   g     u       --   u -        uauu g 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 153962351-153962420 [-]
intergenic
Database links

Mature sequence hsa-miR-6737-5p

Accession MIMAT0027375
Sequence

6 - 

uugggguggucggcccuggag

 - 26

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6737-3p

Accession MIMAT0027376
Sequence

49 - 

ucugugcuucaccccuacccag

 - 70

Get sequence
Deep sequencing43 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).