Stem-loop sequence hsa-mir-6736

AccessionMI0022581 (change log)
Symbol HGNC:MIR6736
DescriptionHomo sapiens miR-6736 stem-loop
Stem-loop
      agc     -     cau   u   uu c 
5' cug   ugggu gaggg   cug ggu  g u
   |||   ||||| |||||   ||| |||  |  
3' gac   accca cucuc   gac ccg  c g
      ---     u     cuc   u   -u g 
Get sequence
Deep sequencing
104 reads, 6.52 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 145850587-145850645 [-]
intergenic
Database links

Mature sequence hsa-miR-6736-5p

Accession MIMAT0027373
Sequence

6 - 

cugggugagggcaucuguggu

 - 26

Get sequence
Deep sequencing88 reads, 38 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6736-3p

Accession MIMAT0027374
Sequence

39 - 

ucagcuccucucuacccacag

 - 59

Get sequence
Deep sequencing14 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).