Stem-loop sequence hsa-mir-6735

AccessionMI0022580 (change log)
Symbol HGNC:MIR6735
DescriptionHomo sapiens miR-6735 stem-loop
Stem-loop
   gcagcc    c  ag g      aau     guga     
5'       aggg ag  g cacagg   cugag    cugg 
         |||| ||  | ||||||   |||||    ||| c
3'       uccc uc  c gugucc   gacuc    gaca 
   ---gac    -  cu g      --g     agaa     
Get sequence
Deep sequencing
433 reads, 1.45 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 43448539-43448611 [+]
sense
OTTHUMT00000020688 ; RP5-848E13.3-002; intron 3
ENST00000431759 ; SLC2A1-AS1-002; intron 3
Database links

Mature sequence hsa-miR-6735-5p

Accession MIMAT0027371
Sequence

6 - 

cagggcagagggcacaggaaucuga

 - 30

Get sequence
Deep sequencing389 reads, 58 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6735-3p

Accession MIMAT0027372
Sequence

52 - 

aggccuguggcuccucccucag

 - 73

Get sequence
Deep sequencing39 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).