Stem-loop sequence hsa-mir-6734

AccessionMI0022579 (change log)
Symbol HGNC:MIR6734
DescriptionHomo sapiens miR-6734 stem-loop
Literature search

1 open access papers mention hsa-mir-6734
(2 sentences)

Stem-loop
   agaacu          a     u    -aagcc     
5'       ugaggggaga ugagg ggag      cagg 
         |||||||||| ||||| ||||      ||| u
3'       acucucuucu acucc cuuc      gucu 
   -----g          c     -    cccuaa     
Get sequence
Deep sequencing
310 reads, 1.08 reads per million, 93 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 43364648-43364715 [-]
intergenic
Database links

Mature sequence hsa-miR-6734-5p

Accession MIMAT0027369
Sequence

6 - 

uugaggggagaaugagguggaga

 - 28

Get sequence
Deep sequencing251 reads, 76 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6734-3p

Accession MIMAT0027370
Sequence

46 - 

cccuucccucacucuucucucag

 - 68

Get sequence
Deep sequencing53 reads, 36 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).