Stem-loop sequence hsa-mir-6732

AccessionMI0022577 (change log)
Symbol HGNC:MIR6732
DescriptionHomo sapiens miR-6732 stem-loop
Stem-loop
   -a  ccu      u  -    -c     auc 
5'   gg   aggggg gg cagg  uggcc   a
     ||   |||||| || ||||  |||||   g
3'   cc   ucccuc cc gucc  aucgg   u
   ga  --c      u  u    ca     gug 
Get sequence
Deep sequencing
77 reads, 2.27 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 37480230-37480289 [+]
antisense
OTTHUMT00000012053 ; GRIK3-001; intron 1
OTTHUMT00000012054 ; GRIK3-002; intron 1
ENST00000373091 ; GRIK3-001; intron 1
ENST00000373093 ; GRIK3-002; intron 1
Database links

Mature sequence hsa-miR-6732-5p

Accession MIMAT0027365
Sequence

6 - 

uaggggguggcaggcuggcc

 - 25

Get sequence
Deep sequencing13 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6732-3p

Accession MIMAT0027366
Sequence

38 - 

uaacccuguccucucccucccag

 - 60

Get sequence
Deep sequencing51 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).