Stem-loop sequence hsa-mir-6731

AccessionMI0022576 (change log)
Symbol HGNC:MIR6731
DescriptionHomo sapiens miR-6731 stem-loop
Stem-loop
   acag u       ca   uauu     a  ucc     c 
5'     g gggagag  ggg    gugga gc   aggug c
       | |||||||  |||    ||||| ||   ||||| a
3'     c cccucuc  ccc    uaucu cg   uccac a
   --ga -       ac   ---u     c  ---     c 
Get sequence
Deep sequencing
197 reads, 2 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 24919345-24919416 [-]
antisense
OTTHUMT00000009288 ; NCMAP-001; intron 1
OTTHUMT00000009289 ; NCMAP-002; intron 1
ENST00000374392 ; NCMAP-001; intron 1
ENST00000486262 ; NCMAP-002; intron 1
Database links

Mature sequence hsa-miR-6731-5p

Accession MIMAT0027363
Sequence

6 - 

ugggagagcaggguauugugga

 - 27

Get sequence
Deep sequencing179 reads, 41 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6731-3p

Accession MIMAT0027364
Sequence

52 - 

ucuauuccccacucuccccag

 - 72

Get sequence
Deep sequencing13 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).