Stem-loop sequence hsa-mir-6730

AccessionMI0022575 (change log)
Symbol HGNC:MIR6730
DescriptionHomo sapiens miR-6730 stem-loop
Stem-loop
   ccgaaagaaa  ug  -     u    -----    ug 
5'           gg  ga ggggu guca     gagc  c
             ||  || ||||| ||||     ||||  a
3'           cc  cu cccca cagu     cucg  g
   -----gacuc  gu  a     -    cccac    uc 
Get sequence
Deep sequencing
71 reads, 51.2 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 12578957-12579023 [-]
intergenic
Database links

Mature sequence hsa-miR-6730-5p

Accession MIMAT0027361
Sequence

6 - 

agaaagguggagggguugucaga

 - 28

Get sequence
Deep sequencing48 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6730-3p

Accession MIMAT0027362
Sequence

45 - 

ccugacaccccaucugcccuca

 - 66

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).