Stem-loop sequence hsa-mir-6729

AccessionMI0022574 (change log)
Symbol HGNC:MIR6729
DescriptionHomo sapiens miR-6729 stem-loop
Stem-loop
   ga   u         c  c     -    cca 
5'   ggg gggcgaggg gg ugagc ggcu   u
     ||| ||||||||| || ||||| ||||   c
3'   cuc cccgcuccc cc acucg ccgg   c
   ga   u         -  u     u    ccc 
Get sequence
Deep sequencing
80 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 12029158-12029222 [+]
sense
OTTHUMT00000006873 ; PLOD1-009; intron 4
OTTHUMT00000006865 ; PLOD1-001; intron 16
ENST00000491536 ; PLOD1-009; intron 4
ENST00000196061 ; PLOD1-001; intron 16
ENST00000376369 ; PLOD1-201; intron 17
Database links

Mature sequence hsa-miR-6729-5p

Accession MIMAT0027359
Sequence

6 - 

ugggcgagggcggcugagcggc

 - 27

Get sequence
Deep sequencing43 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6729-3p

Accession MIMAT0027360
Sequence

45 - 

ucaucccccucgcccucucag

 - 65

Get sequence
Deep sequencing27 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).