Stem-loop sequence hsa-mir-6728

AccessionMI0022573 (change log)
Symbol HGNC:MIR6728
DescriptionHomo sapiens miR-6728 stem-loop
Stem-loop
   cuagauu    u      ac         uuacugcccuguggggc 
5'        ggga gguagg  cagaggggc                 u
          |||| ||||||  |||||||||                  
3'        cccu ucgucu  gucucuucg                 c
   ----gac    c      -c         uaccgugacccaggucu 
Get sequence
Deep sequencing
141 reads, 84.1 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 8866502-8866590 [-]
sense
OTTHUMT00000004916 ; RERE-001; intron 1
OTTHUMT00000366765 ; RERE-014; intron 1
OTTHUMT00000004952 ; RP4-633I8.4-001; intron 1
ENST00000337907 ; RERE-001; intron 1
ENST00000400908 ; RERE-014; intron 1
ENST00000433876 ; RP4-633I8.4-001; intron 1
Database links

Mature sequence hsa-miR-6728-5p

Accession MIMAT0027357
Sequence

6 - 

uugggaugguaggaccagagggg

 - 28

Get sequence
Deep sequencing54 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6728-3p

Accession MIMAT0027358
Sequence

69 - 

ucucugcucugcucuccccag

 - 89

Get sequence
Deep sequencing63 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).