Stem-loop sequence hsa-mir-6727

AccessionMI0022572 (change log)
Symbol HGNC:MIR6727
DescriptionHomo sapiens miR-6727 stem-loop
Stem-loop
   ggg   uc    c   c   u      g ccc  a 
5'    ugc  gggg agg ggc gggagc g   uc c
      |||  |||| ||| ||| |||||| |   || a
3'    acg  cucc ucc ccg uccucg u   ag u
   --g   -c    -   a   -      g ---  u 
Get sequence
Deep sequencing
65 reads, 5.13 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 1312502-1312566 [-]
intergenic
Database links

Mature sequence hsa-miR-6727-5p

Accession MIMAT0027355
Sequence

6 - 

cucggggcaggcggcugggagcg

 - 28

Get sequence
Deep sequencing39 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6727-3p

Accession MIMAT0027356
Sequence

46 - 

uccugccaccuccuccgcag

 - 65

Get sequence
Deep sequencing24 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).