Stem-loop sequence hsa-mir-6726

AccessionMI0022571 (change log)
Symbol HGNC:MIR6726
DescriptionHomo sapiens miR-6726 stem-loop
Stem-loop
   ggg        c      cu      -  g 
5'    ggcgggag uggggu  gcaggu uc c
      |||||||| ||||||  |||||| || a
3'    ucgcccuc gucccg  cguccg ag c
   -ga        u      cu      u  u 
Get sequence
Deep sequencing
78 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 1296110-1296170 [-]
sense
OTTHUMT00000008283 ; MXRA8-002; intron 1
ENST00000477278 ; MXRA8-002; intron 1
Database links

Mature sequence hsa-miR-6726-5p

Accession MIMAT0027353
Sequence

6 - 

cgggagcuggggucugcaggu

 - 26

Get sequence
Deep sequencing28 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6726-3p

Accession MIMAT0027354
Sequence

42 - 

cucgcccugucucccgcuag

 - 61

Get sequence
Deep sequencing48 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).