Stem-loop sequence hsa-mir-6724-1

AccessionMI0022559 (change log)
Previous IDshsa-mir-6724
Symbol HGNC:MIR6724-1
DescriptionHomo sapiens miR-6724-1 stem-loop
Gene family MIPF0001920; mir-6724
Literature search

2 open access papers mention hsa-mir-6724-1
(6 sentences)

Stem-loop
   cgcug   uucu   cc      --    -g    -     -c  g  c  u 
5'      cgc    ggg  cgcggc  gggc  uggg gcugc  cg gc gg c
        |||    |||  ||||||  ||||  |||| |||||  || || ||  
3'      gcg    ccc  gcgccg  cccg  gccc cgaug  gc cg cc g
   ----g   ----   -a      ag    ga    u     cc  g  a  a 
Get sequence
Deep sequencing
1255 reads, 1.57 reads per million, 127 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 8205315-8205406 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6724-1
hsa-mir-6724-1chr21: 8205315-8205406 [+]
hsa-mir-10401chr21: 8206563-8206618 [+]
hsa-mir-3648-1chr21: 8208473-8208652 [+]
hsa-mir-10401chr21: 8250772-8250827 [+]
hsa-mir-10401chr21: 8389610-8389665 [+]
hsa-mir-10401chr21: 8433797-8433852 [+]
Database links

Mature sequence hsa-miR-6724-5p

Accession MIMAT0025856
Sequence

11 - 

cugggcccgcggcgggcgugggg

 - 33

Get sequence
Deep sequencing4788 reads, 126 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).