Stem-loop sequence hsa-mir-6722

AccessionMI0022557 (change log)
Symbol HGNC:MIR6722
DescriptionHomo sapiens miR-6722 stem-loop
Literature search

1 open access papers mention hsa-mir-6722
(1 sentences)

Stem-loop
   g      -   -a   g         aca      g   g 
5'  gccuca ggc  ggc cacccgacc   ugcaug cug u
    |||||| |||  ||| |||||||||   |||||| |||  
3'  cggggu ucg  ccg gugggcugg   acgugc ggc g
   g      g   ga   g         -gg      -   g 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 136746893-136746970 [-]
sense
OTTHUMT00000054941 ; VAV2-003; intron 2
OTTHUMT00000054939 ; VAV2-001; intron 2
OTTHUMT00000054940 ; VAV2-002; intron 2
OTTHUMT00000054942 ; VAV2-004; intron 2
ENST00000406606 ; VAV2-003; intron 2
ENST00000371850 ; VAV2-001; intron 2
ENST00000371851 ; VAV2-002; intron 2
ENST00000486113 ; VAV2-004; intron 2
Database links

Mature sequence hsa-miR-6722-5p

Accession MIMAT0025853
Sequence

11 - 

aggcgcacccgaccacaugc

 - 30

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6722-3p

Accession MIMAT0025854
Sequence

47 - 

ugcaggggucgggugggccagg

 - 68

Get sequence
Deep sequencing11 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).