Stem-loop sequence hsa-mir-6721

AccessionMI0022556 (change log)
Symbol HGNC:MIR6721
DescriptionHomo sapiens miR-6721 stem-loop
Stem-loop
   cccucauc      c     c   uu     --     cuga  a 
5'         ucuggg agggg uua  guagg  agucu    ag g
           |||||| ||||| |||  |||||  |||||    ||  
3'         ggaccc uuccc aau  cgucc  ucagg    uc a
   uuacccuu      c     -   uu     ag     --ug  g 
Get sequence
Deep sequencing
436 reads, 2.86 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 32170030-32170116 [-]
sense
OTTHUMT00000268999 ; NOTCH4-003; exon 2
OTTHUMT00000076045 ; NOTCH4-001; exon 21
ENST00000474612 ; NOTCH4-003; exon 2
ENST00000375023 ; NOTCH4-001; exon 21
Clustered miRNAs
< 10kb from hsa-mir-6721
hsa-mir-6833chr6: 32179816-32179876 [+]
hsa-mir-6721chr6: 32170030-32170116 [-]
Database links

Mature sequence hsa-miR-6721-5p

Accession MIMAT0025852
Sequence

11 - 

ugggcaggggcuuauuguaggag

 - 33

Get sequence
Deep sequencing383 reads, 54 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).