Stem-loop sequence hsa-mir-6720

AccessionMI0022555 (change log)
Symbol HGNC:MIR6720
DescriptionHomo sapiens miR-6720 stem-loop
Literature search

1 open access papers mention hsa-mir-6720
(2 sentences)

Stem-loop
   uugagcgagagauuguggcgcaccgagu   u    -c    g       c  ggaag 
5'                             ucu ccag  ccug uaggcgc gc     a
                               ||| ||||  |||| ||||||| ||     a
3'                             aga gguc  ggac guccgcg cg     g
   ------------------gagucgcucu   u    aa    -       -  aaggg 
Get sequence
Deep sequencing
1297 reads, 1.8 reads per million, 111 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 1390314-1390411 [-]
antisense
OTTHUMT00000043558 ; FOXF2-001; 3'UTR (exon 1)
ENST00000259806 ; FOXF2-001; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-6720-5p

Accession MIMAT0027345
Sequence

31 - 

uuccagcccugguaggcgccgcg

 - 53

Get sequence
Deep sequencing406 reads, 50 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-6720-3p

Accession MIMAT0025851
Sequence

67 - 

cgcgccugcaggaacugguaga

 - 88

Get sequence
Deep sequencing883 reads, 102 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).