Stem-loop sequence hsa-mir-6719

AccessionMI0022554 (change log)
Symbol HGNC:MIR6719
DescriptionHomo sapiens miR-6719 stem-loop
Stem-loop
   gcccuacucu        -g         uuca     g  uu 
5'           caggagga  gcugauguc    gagca gg  u
             ||||||||  |||||||||    ||||| ||   
3'           guccucuu  ugacuacag    uucgu uc  g
   uauuuucguc        ag         ucuc     g  ug 
Get sequence
Deep sequencing
87 reads, 33.3 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 39829716-39829802 [-]
sense
OTTHUMT00000464464 ; GMFG-012; intron 1
ENST00000600322 ; GMFG-012; intron 1
Database links

Mature sequence hsa-miR-6719-3p

Accession MIMAT0025850
Sequence

56 - 

ucugacaucagugauucuccug

 - 77

Get sequence
Deep sequencing25 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).