Stem-loop sequence hsa-mir-6718

AccessionMI0022553 (change log)
Symbol HGNC:MIR6718
DescriptionHomo sapiens miR-6718 stem-loop
Stem-loop
   ag                                auu  g 
5'   ugaaucccuaguggucagagggcuuaugauau   gu a
     ||||||||||||||||||||||||||||||||   ||  
3'   acuuagggaucaccgguuuuccgaauacugua   cg g
   ua                                --c  a 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 3885353-3885432 [+]
sense
OTTHUMT00000441782 ; RP11-340P19.1-002; intron 1
ENST00000577649 ; DLGAP1-AS3-002; intron 1
antisense
OTTHUMT00000254394 ; DLGAP1-001; intron 3
OTTHUMT00000443481 ; DLGAP1-021; intron 3
ENST00000515196 ; DLGAP1-201; intron 2
ENST00000315677 ; DLGAP1-001; intron 3
ENST00000581527 ; DLGAP1-021; intron 3
Database links

Mature sequence hsa-miR-6718-5p

Accession MIMAT0025849
Sequence

11 - 

uaguggucagagggcuuauga

 - 31

Get sequence
Deep sequencing47 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).