Stem-loop sequence hsa-mir-6717

AccessionMI0022551 (change log)
Symbol HGNC:MIR6717
DescriptionHomo sapiens miR-6717 stem-loop
Stem-loop
   c     uu ga    au       u  a     aac 
5'  uggug  u  ggcg  gugggga gu gagac   u
    |||||  |  ||||  ||||||| || |||||   u
3'  accac  g  ccgu  uacuccu ua cucug   c
   u     cg -a    cc       u  -     acc 
Get sequence
Deep sequencing
92 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 21023314-21023386 [-]
intergenic
Database links

Mature sequence hsa-miR-6717-5p

Accession MIMAT0025846
Sequence

11 - 

aggcgauguggggauguagaga

 - 32

Get sequence
Deep sequencing79 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).