Stem-loop sequence hsa-mir-6716

AccessionMI0022550 (change log)
Symbol HGNC:MIR6716
DescriptionHomo sapiens miR-6716 stem-loop
Stem-loop
   g    -  caagac uu          -  aa      ucu 
5'  agag gc      c  gggaaugggg gu  gggccu   g
    |||| ||      |  |||||||||| ||  ||||||   a
3'  ucuc cg      g  uccuuaccuc ca  ccugga   g
   -    g  --agac uc          u  ag      ccc 
Get sequence
Deep sequencing
423 reads, 13.8 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 118644000-118644079 [+]
antisense
OTTHUMT00000389648 ; DDX6-003; intron 2
OTTHUMT00000389645 ; DDX6-001; intron 4
OTTHUMT00000389647 ; DDX6-002; intron 4
ENST00000525082 ; DDX6-003; intron 2
ENST00000264018 ; DDX6-001; intron 4
ENST00000526070 ; DDX6-002; intron 4
ENST00000534980 ; DDX6-201; intron 4
Database links

Mature sequence hsa-miR-6716-5p

Accession MIMAT0025844
Sequence

16 - 

ugggaauggggguaagggcc

 - 35

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-6716-3p

Accession MIMAT0025845
Sequence

49 - 

uccgaacucuccauuccucugc

 - 70

Get sequence
Deep sequencing401 reads, 71 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).