Stem-loop sequence hsa-mir-6715a

AccessionMI0022548 (change log)
Symbol HGNC:MIR6715A
DescriptionHomo sapiens miR-6715a stem-loop
Gene family MIPF0001708; mir-6715
Literature search

3 open access papers mention hsa-mir-6715a
(40 sentences)

Stem-loop
   u   c  c            a  c      a   u   u 
5'  ggg ug guccacaggcac gc gguuug gca uuu a
    ||| || |||||||||||| || |||||| ||| |||  
3'  ucc ac cggguguccgug ug ccaaac cgu aag c
   u   a  a            c  a      -   u   u 
Get sequence
Deep sequencing
19 reads, 25 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 112299612-112299690 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6715a
hsa-mir-6715achr10: 112299612-112299690 [+]
hsa-mir-6715bchr10: 112299612-112299688 [-]
Database links

Mature sequence hsa-miR-6715a-3p

Accession MIMAT0025841
Sequence

49 - 

ccaaaccagucgugccugugg

 - 69

Get sequence
Deep sequencing14 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).