Stem-loop sequence hsa-mir-671

AccessionMI0003760 (change log)
Symbol HGNC:MIR671
DescriptionHomo sapiens miR-671 stem-loop
Gene family MIPF0000358; mir-671
Literature search

40 open access papers mention hsa-mir-671
(289 sentences)

Stem-loop
      ggu aa     ----a    a        a   a      ga           -u   g 
5' gca   g  cuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
   |||   |  |||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
3' cgu   c  gaccg     ccgg cuuucucc ccu cgggac  ucuuggccucc  uug a
      ggu gg     agaug    g        a   -      --           uu   u 
Get sequence
Deep sequencing
33767 reads, 77.1 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 151238421-151238538 [+]
intergenic
Database links

Mature sequence hsa-miR-671-5p

Accession MIMAT0003880
Previous IDshsa-miR-671
Sequence

29 - 

aggaagcccuggaggggcuggag

 - 51

Get sequence
Deep sequencing30212 reads, 147 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-671-3p

Accession MIMAT0004819
Sequence

68 - 

uccgguucucagggcuccacc

 - 88

Get sequence
Deep sequencing3365 reads, 148 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).