Stem-loop sequence hsa-mir-665

AccessionMI0005563 (change log)
Symbol HGNC:MIR665
DescriptionHomo sapiens miR-665 stem-loop
Gene family MIPF0000404; mir-665
Literature search

18 open access papers mention hsa-mir-665
(36 sentences)

Stem-loop
   -  u   -c          u      -acc  g  c 
5'  uc ccu  gaggggucuc gccucu    ca ga u
    || |||  |||||||||| ||||||    || || c
3'  gg gga  cuccccggag cggagg    gu cu u
   c  c   ca          u      acca  a  u 
Get sequence
Deep sequencing
986 reads, 14.3 reads per million, 105 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100875033-100875104 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-665
hsa-mir-493chr14: 100869060-100869148 [+]
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
hsa-mir-136chr14: 100884702-100884783 [+]
Database links

Mature sequence hsa-miR-665

Accession MIMAT0004952
Sequence

43 - 

accaggaggcugaggccccu

 - 62

Get sequence
Deep sequencing927 reads, 103 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).