Stem-loop sequence hsa-mir-664a

AccessionMI0006442 (change log)
Previous IDshsa-mir-664
Symbol HGNC:MIR664A
DescriptionHomo sapiens miR-664 stem-loop
Gene family MIPF0000300; mir-664
Literature search

32 open access papers mention hsa-mir-664a
(96 sentences)

Stem-loop
   ---gaa    gaaacu    a    aaa   u         ac 
5'       cauu      ggcu ggga   uga uggauagaa  u
         ||||      |||| ||||   ||| |||||||||  a
3'       guaa      ccga cccu   auu acuuaucuu  u
   aaaaaa    -aacau    c    ---   u         au 
Get sequence
Deep sequencing
67538 reads, 64.1 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence overlaps an annotated snoRNA, ACA38b. However, both miR and miR* sequences are identified in reference [1], and the sequence is homologous with rat mir-664.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 220200538-220200619 [-]
sense
OTTHUMT00000472438 ; EPRS-006; intron 5
OTTHUMT00000091133 ; EPRS-001; intron 6
OTTHUMT00000472508 ; EPRS-007; intron 6
ENST00000477030 ; EPRS-006; intron 5
ENST00000366923 ; EPRS-001; intron 6
ENST00000609181 ; EPRS-007; intron 6
Database links

Mature sequence hsa-miR-664a-5p

Accession MIMAT0005948
Previous IDshsa-miR-664*;hsa-miR-664-5p
Sequence

11 - 

acuggcuagggaaaaugauuggau

 - 34

Get sequence
Deep sequencing28229 reads, 148 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-664a-3p

Accession MIMAT0005949
Previous IDshsa-miR-664;hsa-miR-664-3p
Sequence

49 - 

uauucauuuauccccagccuaca

 - 71

Get sequence
Deep sequencing39183 reads, 152 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).