Stem-loop sequence hsa-mir-658

AccessionMI0003682 (change log)
Symbol HGNC:MIR658
DescriptionHomo sapiens miR-658 stem-loop
Gene family MIPF0000643; mir-658
Literature search

6 open access papers mention hsa-mir-658
(9 sentences)

Stem-loop
   g    g  g   - g --uu       --  g   gc     --agc   c  a 
5'  cucg uu ccg u g    gcgggcc  cu ccc  ccgcc     ucg ug c
    |||| || ||| | |    |||||||  || |||  |||||     ||| ||  
3'  gagc aa ggc g c    ugccugg  ga ggg  ggcgg     agc ac a
   g    -  g   u g uggu       au  a   -a     gacuc   -  g 
Get sequence
Deep sequencing
245 reads, 1.82 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 37844272-37844371 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-658
hsa-mir-659chr22: 37847678-37847774 [-]
hsa-mir-658chr22: 37844272-37844371 [-]
Database links

Mature sequence hsa-miR-658

Accession MIMAT0003336
Sequence

61 - 

ggcggagggaaguagguccguuggu

 - 85

Get sequence
Deep sequencing224 reads, 48 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).