Stem-loop sequence hsa-mir-657

AccessionMI0003681 (change log)
Symbol HGNC:MIR657
DescriptionHomo sapiens miR-657 stem-loop
Gene family MIPF0000498; mir-657
Literature search

10 open access papers mention hsa-mir-657
(11 sentences)

Stem-loop
   guguaguagagcua        --   u        agcguggaccgguccgggu 
5'               ggaggaga  ggg ccuggaga                   g
                 ||||||||  ||| ||||||||                   g
3'               ucuccucu  ccc ggaucucu                   g
   -------------g        ua   c        cccacucuuggacggccuu 
Get sequence
Deep sequencing
65 reads, 7.41 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 81125276-81125373 [-]
antisense
OTTHUMT00000438910 ; AC139099.4-001; exon 3
ENST00000572343 ; AC139099.4-001; exon 3
Clustered miRNAs
< 10kb from hsa-mir-657
hsa-mir-1250chr17: 81133196-81133308 [-]
hsa-mir-338chr17: 81125883-81125949 [-]
hsa-mir-3065chr17: 81125877-81125955 [+]
hsa-mir-657chr17: 81125276-81125373 [-]
Database links

Mature sequence hsa-miR-657

Accession MIMAT0003335
Sequence

61 - 

ggcagguucucacccucucuagg

 - 83

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).