Stem-loop sequence hsa-mir-6516

AccessionMI0025513 (change log)
Symbol HGNC:MIR6516
DescriptionHomo sapiens miR-6516 stem-loop
Gene family MIPF0001672; mir-6516
Literature search

2 open access papers mention hsa-mir-6516
(3 sentences)

Stem-loop
            aa         a  g ug   g    cu   a 
5' uggguuuug  uuugcagua ca g  uga cauu  agc g
   |||||||||  ||||||||| || |  ||| ||||  |||  
3' auccaggac  aaacgucau gu u  acu guag  uug c
            --         a  a gu   a    -u   a 
Get sequence
Deep sequencing
4991 reads, 2.96 reads per million, 135 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 77089417-77089497 [+]
antisense
OTTHUMT00000437660 ; RBFOX3-011; intron 3
OTTHUMT00000437657 ; RBFOX3-006; intron 5
OTTHUMT00000437659 ; RBFOX3-005; intron 5
OTTHUMT00000437661 ; RBFOX3-010; intron 5
OTTHUMT00000437656 ; RBFOX3-007; intron 10
OTTHUMT00000316742 ; RBFOX3-002; intron 13
OTTHUMT00000437658 ; RBFOX3-004; intron 14
ENST00000582880 ; RBFOX3-011; intron 3
ENST00000581393 ; RBFOX3-006; intron 5
ENST00000578998 ; RBFOX3-005; intron 5
ENST00000582894 ; RBFOX3-010; intron 5
ENST00000582043 ; RBFOX3-007; intron 10
ENST00000583458 ; RBFOX3-002; intron 13
ENST00000415831 ; RBFOX3-201; intron 13
ENST00000580155 ; RBFOX3-004; intron 14
ENST00000453134 ; RBFOX3-202; intron 14
Database links

Mature sequence hsa-miR-6516-5p

Accession MIMAT0030417
Sequence

12 - 

uuugcaguaacaggugugagca

 - 33

Get sequence
Deep sequencing967 reads, 131 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6516-3p

Accession MIMAT0030418
Sequence

53 - 

aucauguaugauacugcaaaca

 - 74

Get sequence
Deep sequencing3967 reads, 116 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).