Stem-loop sequence hsa-mir-6514

AccessionMI0022226 (change log)
Symbol HGNC:MIR6514
DescriptionHomo sapiens miR-6514 stem-loop
Literature search

1 open access papers mention hsa-mir-6514
(2 sentences)

Stem-loop
   ua         cuuu   cuggcauuuacgaguc 
5'   uggagugga    cag                a
     |||||||||    |||                g
3'   accucaccu    guc                a
   -g         ucuu   cgucgagacauucuug 
Get sequence
Deep sequencing
847 reads, 0 reads per million, 90 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 62792702-62792771 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6514
hsa-mir-6514chr11: 62792702-62792771 [-]
hsa-mir-6748chr11: 62789815-62789885 [+]
Database links

Mature sequence hsa-miR-6514-5p

Accession MIMAT0025484
Sequence

1 - 

uauggaguggacuuucagcuggc

 - 23

Get sequence
Deep sequencing786 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6514-3p

Accession MIMAT0025485
Sequence

50 - 

cugccuguucuuccacuccag

 - 70

Get sequence
Deep sequencing35 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).