Stem-loop sequence hsa-mir-6513

AccessionMI0022225 (change log)
Symbol HGNC:MIR6513
DescriptionHomo sapiens miR-6513 stem-loop
Stem-loop
       u     u  c c   a  u     guc 
5' gcuu gggau ga g cac ug cucag   c
   |||| ||||| || | ||| || |||||    
3' cgga cccug cu c gug ac gaguc   c
       u     u  a u   a  u     gac 
Get sequence
Deep sequencing
436 reads, 2.44 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 218280125-218280188 [-]
sense
OTTHUMT00000339331 ; DIRC3-003; intron 7
OTTHUMT00000339330 ; DIRC3-002; intron 8
ENST00000474063 ; DIRC3-003; intron 7
ENST00000486365 ; DIRC3-002; intron 8
Database links

Mature sequence hsa-miR-6513-5p

Accession MIMAT0025482
Sequence

3 - 

uuugggauugacgccacaugucu

 - 25

Get sequence
Deep sequencing384 reads, 76 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6513-3p

Accession MIMAT0025483
Sequence

42 - 

ucaagugucaucugucccuag

 - 62

Get sequence
Deep sequencing50 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).