Stem-loop sequence hsa-mir-6512

AccessionMI0022224 (change log)
Symbol HGNC:MIR6512
DescriptionHomo sapiens miR-6512 stem-loop
Stem-loop
   u                   a             ugag 
5'  augcucuuaccauuagaag gcuggaagaaggc    g
    ||||||||||||||||||| |||||||||||||     
3'  uacgaggaugguaaucuuc cgaccuucuuccg    g
   -                   c             uaga 
Get sequence
Deep sequencing
72 reads, 2.94 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 177313806-177313882 [-]
intergenic
Database links

Mature sequence hsa-miR-6512-5p

Accession MIMAT0025480
Sequence

9 - 

uaccauuagaagagcuggaaga

 - 30

Get sequence
Deep sequencing56 reads, 24 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6512-3p

Accession MIMAT0025481
Sequence

51 - 

uuccagcccuucuaaugguagg

 - 72

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).