Stem-loop sequence hsa-mir-6510

AccessionMI0022222 (change log)
Symbol HGNC:MIR6510
DescriptionHomo sapiens miR-6510 stem-loop
Literature search

2 open access papers mention hsa-mir-6510
(3 sentences)

Stem-loop
   agca        g    -a  a   c 
5'     gcagggga agag  gg guc u
       |||||||| ||||  || ||| c
3'     cguccucu ucuc  cc cag u
   uaga        g    ag  a   a 
Get sequence
Deep sequencing
1592 reads, 5.41 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 41517164-41517217 [-]
intergenic
Database links

Mature sequence hsa-miR-6510-5p

Accession MIMAT0025476
Sequence

3 - 

cagcaggggagagagaggaguc

 - 24

Get sequence
Deep sequencing45 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6510-3p

Accession MIMAT0025477
Sequence

32 - 

caccgacucugucuccugcag

 - 52

Get sequence
Deep sequencing1547 reads, 67 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).