Stem-loop sequence hsa-mir-6509

AccessionMI0022221 (change log)
Symbol HGNC:MIR6509
DescriptionHomo sapiens miR-6509 stem-loop
Stem-loop
   u   ug g  u                       c   auau 
5'  uuu  u ug gaaauuagguaguggcaguggaa acu    u
    |||  | || ||||||||||||||||||||||| |||     
3'  aag  a ac cuuuaauccaucaccgucaccuu ugg    a
   a   gu g  u                       -   acua 
Get sequence
Deep sequencing
159 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 135206994-135207078 [-]
intergenic
Database links

Mature sequence hsa-miR-6509-5p

Accession MIMAT0025474
Sequence

15 - 

auuagguaguggcaguggaac

 - 35

Get sequence
Deep sequencing99 reads, 35 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-6509-3p

Accession MIMAT0025475
Sequence

52 - 

uuccacugccacuaccuaauuu

 - 73

Get sequence
Deep sequencing60 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).
2
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).