Stem-loop sequence hsa-mir-6508

AccessionMI0022220 (change log)
Symbol HGNC:MIR6508
DescriptionHomo sapiens miR-6508 stem-loop
Stem-loop
   -uucc              a      cug 
5'      ucuagaaaugcaug cccacc   a
        |||||||||||||| ||||||   g
3'      agaucuuuacguac gggugg   u
   ccuca              c      uuu 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 39447010-39447069 [+]
antisense
OTTHUMT00000194835 ; DSCR4-002; intron 2
OTTHUMT00000194834 ; DSCR4-001; intron 2
ENST00000398948 ; DSCR4-002; intron 2
ENST00000328264 ; DSCR4-001; intron 2
Database links

Mature sequence hsa-miR-6508-5p

Accession MIMAT0025472
Sequence

5 - 

ucuagaaaugcaugacccacc

 - 25

Get sequence
Deep sequencing17 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6508-3p

Accession MIMAT0025473
Sequence

37 - 

ugggccaugcauuucuagaacu

 - 58

Get sequence
Deep sequencing95 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).