Stem-loop sequence hsa-mir-6507

AccessionMI0022219 (change log)
Symbol HGNC:MIR6507
DescriptionHomo sapiens miR-6507 stem-loop
Stem-loop
                             auu     u 
5' ggagggaagaauaggagggacuuugu   guggu c
   ||||||||||||||||||||||||||   ||||| a
3' ccucccuuuuuauccuuccugaaacg   uacca g
                             ---     u 
Get sequence
Deep sequencing
1135 reads, 2.97 reads per million, 101 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 98924499-98924568 [-]
sense
OTTHUMT00000049636 ; SLIT1-001; intron 2
OTTHUMT00000049638 ; SLIT1-003; intron 2
OTTHUMT00000049641 ; SLIT1-006; intron 2
OTTHUMT00000049639 ; SLIT1-004; intron 2
OTTHUMT00000467772 ; SLIT1-009; intron 2
OTTHUMT00000467774 ; RP11-453E2.3-001; intron 12
ENST00000266058 ; SLIT1-001; intron 2
ENST00000371070 ; SLIT1-003; intron 2
ENST00000314867 ; SLIT1-006; intron 2
ENST00000371041 ; SLIT1-004; intron 2
ENST00000456008 ; SLIT1-009; intron 2
ENST00000479633 ; ARHGAP19-SLIT1-001; intron 12
ENST00000453547 ; ARHGAP19-SLIT1-203; intron 12
Database links

Mature sequence hsa-miR-6507-5p

Accession MIMAT0025470
Sequence

6 - 

gaagaauaggagggacuuugu

 - 26

Get sequence
Deep sequencing661 reads, 94 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6507-3p

Accession MIMAT0025471
Sequence

46 - 

caaaguccuuccuauuuuuccc

 - 67

Get sequence
Deep sequencing72 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).