Stem-loop sequence hsa-mir-6506

AccessionMI0022218 (change log)
Symbol HGNC:MIR6506
DescriptionHomo sapiens miR-6506 stem-loop
Stem-loop
   ---ga       g  ac   a         u  ga 
5'      cugggau uc  uga uaugguguu gu  g
        ||||||| ||  ||| ||||||||| ||   
3'      gaccuua ag  acu augcuacag ua  u
   acaca       g  --   -         u  gu 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 15611030-15611095 [-]
antisense
OTTHUMT00000422461 ; C16orf45-009; intron 1
OTTHUMT00000422462 ; C16orf45-010; intron 1
OTTHUMT00000252130 ; C16orf45-001; intron 2
OTTHUMT00000422455 ; C16orf45-004; intron 2
OTTHUMT00000422458 ; C16orf45-007; intron 2
OTTHUMT00000422459 ; C16orf45-011; intron 2
OTTHUMT00000422460 ; C16orf45-002; intron 2
OTTHUMT00000422457 ; C16orf45-006; intron 3
ENST00000564389 ; C16orf45-009; intron 1
ENST00000561692 ; C16orf45-010; intron 1
ENST00000300006 ; C16orf45-001; intron 2
ENST00000566490 ; C16orf45-004; intron 2
ENST00000561813 ; C16orf45-007; intron 2
ENST00000567550 ; C16orf45-011; intron 2
ENST00000452191 ; C16orf45-002; intron 2
ENST00000570249 ; C16orf45-006; intron 3
Database links

Mature sequence hsa-miR-6506-5p

Accession MIMAT0025468
Sequence

2 - 

acugggaugucacugaauauggu

 - 24

Get sequence
Deep sequencing40 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6506-3p

Accession MIMAT0025469
Sequence

44 - 

ucguaucagagauuccagacac

 - 65

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).