Stem-loop sequence hsa-mir-6505

AccessionMI0022217 (change log)
Symbol HGNC:MIR6505
DescriptionHomo sapiens miR-6505 stem-loop
Gene family MIPF0001805; mir-6505
Stem-loop
   gca      u   -   uauc     auguugag    gu 
5'    uuggaa agg gga    ucagc        cccu  c
      |||||| ||| |||    |||||        ||||   
3'    aaccuu ucc ucu    agucg        gggg  u
   -ga      c   a   --uc     -------a    uc 
Get sequence
Deep sequencing
509 reads, 1.41 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 48132797-48132867 [+]
sense
OTTHUMT00000405347 ; RP1-197B17.3-001; intron 5
ENST00000547799 ; RP1-197B17.3-001; intron 5
antisense
OTTHUMT00000257854 ; RAPGEF3-010; intron 1
OTTHUMT00000257851 ; RAPGEF3-006; intron 6
OTTHUMT00000257863 ; RAPGEF3-014; intron 7
OTTHUMT00000257841 ; RAPGEF3-002; intron 8
OTTHUMT00000405355 ; RAPGEF3-016; intron 20
OTTHUMT00000257849 ; RAPGEF3-004; intron 21
OTTHUMT00000257850 ; RAPGEF3-005; intron 22
OTTHUMT00000257840 ; RAPGEF3-007; intron 23
OTTHUMT00000257848 ; RAPGEF3-001; intron 24
OTTHUMT00000405502 ; RAPGEF3-018; intron 24
OTTHUMT00000405356 ; RAPGEF3-017; intron 25
ENST00000490387 ; RAPGEF3-010; intron 1
ENST00000488250 ; RAPGEF3-006; intron 6
ENST00000548434 ; RAPGEF3-014; intron 7
ENST00000395360 ; RAPGEF3-002; intron 8
ENST00000547856 ; RAPGEF3-016; intron 20
ENST00000479866 ; RAPGEF3-004; intron 21
ENST00000482843 ; RAPGEF3-005; intron 22
ENST00000548919 ; RAPGEF3-007; intron 23
ENST00000449771 ; RAPGEF3-001; intron 24
ENST00000549151 ; RAPGEF3-018; intron 24
ENST00000405493 ; RAPGEF3-202; intron 24
ENST00000171000 ; RAPGEF3-201; intron 24
ENST00000389212 ; RAPGEF3-017; intron 25
Database links

Mature sequence hsa-miR-6505-5p

Accession MIMAT0025466
Sequence

4 - 

uuggaauaggggauaucucagc

 - 25

Get sequence
Deep sequencing455 reads, 60 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6505-3p

Accession MIMAT0025467
Sequence

51 - 

ugacuucuaccucuuccaaag

 - 71

Get sequence
Deep sequencing43 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).