Stem-loop sequence hsa-mir-6504

AccessionMI0022216 (change log)
Symbol HGNC:MIR6504
DescriptionHomo sapiens miR-6504 stem-loop
Stem-loop
   gc  uc                    cug 
5'   ag  uggcugugcuguaaugcagu   c
     ||  ||||||||||||||||||||   a
3'   uc  accgacacgacauuacgucg   c
   uc  uu                    ucc 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 81611348-81611408 [+]
sense
OTTHUMT00000432399 ; CMIP-001; intron 1
OTTHUMT00000432400 ; CMIP-002; intron 1
ENST00000537098 ; CMIP-001; intron 1
ENST00000539778 ; CMIP-002; intron 1
Database links

Mature sequence hsa-miR-6504-5p

Accession MIMAT0025464
Sequence

5 - 

ucuggcugugcuguaaugcag

 - 25

Get sequence
Deep sequencing53 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6504-3p

Accession MIMAT0025465
Sequence

40 - 

cauuacagcacagccauucu

 - 59

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).