Stem-loop sequence hsa-mir-6503

AccessionMI0022215 (change log)
Symbol HGNC:MIR6503
DescriptionHomo sapiens miR-6503 stem-loop
Literature search

1 open access papers mention hsa-mir-6503
(3 sentences)

Stem-loop
              c                aaauccccagaagc 
5' aaugguccccc agggaggucugcauuc              u
   ||||||||||| ||||||||||||||||              g
3' uuaccaggggg ucccuccagacguagg              a
              -                aucaggggauuagg 
Get sequence
Deep sequencing
1994 reads, 0 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 60209071-60209156 [-]
antisense
OTTHUMT00000395396 ; MS4A5-005; intron 3
OTTHUMT00000395397 ; MS4A5-006; intron 3
OTTHUMT00000395392 ; MS4A5-001; intron 4
OTTHUMT00000395393 ; MS4A5-002; intron 4
OTTHUMT00000395395 ; MS4A5-004; intron 4
ENST00000528905 ; MS4A5-005; intron 3
ENST00000528093 ; MS4A5-006; intron 3
ENST00000300190 ; MS4A5-001; intron 4
ENST00000533885 ; MS4A5-002; intron 4
ENST00000531403 ; MS4A5-004; intron 4
Database links

Mature sequence hsa-miR-6503-5p

Accession MIMAT0025462
Sequence

17 - 

aggucugcauucaaauccccaga

 - 39

Get sequence
Deep sequencing622 reads, 64 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6503-3p

Accession MIMAT0025463
Sequence

53 - 

gggacuaggaugcagaccucc

 - 73

Get sequence
Deep sequencing1356 reads, 66 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).