Stem-loop sequence hsa-mir-6502

AccessionMI0022214 (change log)
Symbol HGNC:MIR6502
DescriptionHomo sapiens miR-6502 stem-loop
Stem-loop
   c       --ga             u   -gac    ca 
5'  agagugg    gcucuagaaagau guu    caau  u
    |||||||    ||||||||||||| |||    ||||   
3'  uuuuauc    ugagaucuuucua cag    guua  c
   -       aaua             c   auca    uu 
Get sequence
Deep sequencing
94 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 66251082-66251157 [+]
sense
OTTHUMT00000401665 ; HMGA2-012; intron 2
OTTHUMT00000401654 ; HMGA2-001; intron 3
OTTHUMT00000401657 ; HMGA2-007; intron 3
OTTHUMT00000401658 ; HMGA2-006; intron 3
OTTHUMT00000401659 ; HMGA2-003; intron 3
OTTHUMT00000401660 ; HMGA2-008; intron 3
OTTHUMT00000401662 ; HMGA2-011; intron 3
OTTHUMT00000401663 ; HMGA2-013; intron 3
ENST00000539662 ; HMGA2-012; intron 2
ENST00000403681 ; HMGA2-001; intron 3
ENST00000537429 ; HMGA2-007; intron 3
ENST00000425208 ; HMGA2-006; intron 3
ENST00000536545 ; HMGA2-003; intron 3
ENST00000354636 ; HMGA2-008; intron 3
ENST00000541363 ; HMGA2-011; intron 3
ENST00000393577 ; HMGA2-013; intron 3
antisense
OTTHUMT00000401746 ; RP11-366L20.2-004; intron 2
OTTHUMT00000401747 ; RP11-366L20.2-001; 3'UTR (exon 3)
ENST00000439236 ; RP11-366L20.2-004; intron 2
ENST00000356215 ; RP11-366L20.2-001; 3'UTR (exon 3)
Database links

Mature sequence hsa-miR-6502-5p

Accession MIMAT0025460
Sequence

10 - 

agcucuagaaagauuguugacc

 - 31

Get sequence
Deep sequencing90 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6502-3p

Accession MIMAT0025461
Sequence

47 - 

uagaccaucuuucuagaguau

 - 67

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).