Stem-loop sequence hsa-mir-6501

AccessionMI0022213 (change log)
Symbol HGNC:MIR6501
DescriptionHomo sapiens miR-6501 stem-loop
Stem-loop
   -gga      -a       c     ug  --a  a 
5'     guugcc  gggcugc uuugg  ac   gc g
       ||||||  ||||||| |||||  ||   ||  
3'     caaugg  uccgacg agacc  ug   ug c
   auga      cg       -     gu  aga  a 
Get sequence
Deep sequencing
200 reads, 0 reads per million, 84 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 33550662-33550728 [+]
antisense
OTTHUMT00000193088 ; NCRNA00159-001; intron 1
ENST00000414877 ; LINC00159-001; intron 1
Database links

Mature sequence hsa-miR-6501-5p

Accession MIMAT0025458
Sequence

3 - 

aguugccagggcugccuuuggu

 - 24

Get sequence
Deep sequencing139 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6501-3p

Accession MIMAT0025459
Sequence

44 - 

ccagagcagccugcgguaacagu

 - 66

Get sequence
Deep sequencing59 reads, 32 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).