Stem-loop sequence hsa-mir-6500

AccessionMI0022211 (change log)
Symbol HGNC:MIR6500
DescriptionHomo sapiens miR-6500 stem-loop
Gene family MIPF0001548; mir-4421
Literature search

1 open access papers mention hsa-mir-6500
(2 sentences)

Stem-loop
              aa   agc     a uc         -u    u 
5' ccugccugcag  agg   uaucc c  caggugucc  uucu c
   |||||||||||  |||   ||||| |  |||||||||  ||||  
3' ggauggacguc  ucc   guagg g  guucacagg  gaga u
              cg   --a     - uu         uc    g 
Get sequence
Deep sequencing
647 reads, 58.6 reads per million, 99 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 51060018-51060103 [+]
antisense
OTTHUMT00000092438 ; FAF1-005; intron 2
OTTHUMT00000021808 ; FAF1-002; intron 3
OTTHUMT00000021807 ; FAF1-001; intron 9
ENST00000472808 ; FAF1-005; intron 2
ENST00000545823 ; FAF1-202; intron 2
ENST00000494400 ; FAF1-002; intron 3
ENST00000396153 ; FAF1-001; intron 9
ENST00000371778 ; FAF1-201; intron 10
Clustered miRNAs
< 10kb from hsa-mir-6500
hsa-mir-4421chr1: 51059837-51059905 [+]
hsa-mir-6500chr1: 51060018-51060103 [+]
Database links

Mature sequence hsa-miR-6500-5p

Accession MIMAT0025454
Sequence

14 - 

aggagcuauccacuccaggugucc

 - 37

Get sequence
Deep sequencing25 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-6500-3p

Accession MIMAT0025455
Sequence

55 - 

acacuuguugggaugaccugc

 - 75

Get sequence
Deep sequencing559 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).