Stem-loop sequence hsa-mir-6499

AccessionMI0022209 (change log)
Symbol HGNC:MIR6499
DescriptionHomo sapiens miR-6499 stem-loop
Stem-loop
   uca  c     -caa         a   -  g 
5'    gu gggcg    gagcacugc guu cu u
      || |||||    ||||||||| ||| ||  
3'    ca cccgu    uuugugacg cag gg u
   -ga  -     uuug         a   u  g 
Get sequence
Deep sequencing
1381 reads, 7.32 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 151522087-151522148 [-]
antisense
OTTHUMT00000373982 ; CTB-12O2.1-004; intron 1
OTTHUMT00000373979 ; CTB-12O2.1-001; intron 3
ENST00000524034 ; CTB-12O2.1-004; intron 1
ENST00000524295 ; CTB-12O2.1-001; intron 3
Database links

Mature sequence hsa-miR-6499-5p

Accession MIMAT0025450
Sequence

5 - 

ucgggcgcaagagcacugcagu

 - 26

Get sequence
Deep sequencing1377 reads, 40 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-6499-3p

Accession MIMAT0025451
Sequence

40 - 

agcaguguuuguuuugcccaca

 - 61

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).