Stem-loop sequence hsa-mir-649

AccessionMI0003664 (change log)
Symbol HGNC:MIR649
DescriptionHomo sapiens miR-649 stem-loop
Gene family MIPF0000547; mir-649
Literature search

3 open access papers mention hsa-mir-649
(3 sentences)

Stem-loop
   ggcc    c      u  --        u      uu    gaaa     c 
5'     uagc aaauac gu  auuuuuga cgacau  gguu    aauau u
       |||| |||||| ||  |||||||| ||||||  ||||    |||||  
3'     gucg uuugug ca  ugagaacu guugug  ccaa    uuaug a
   ----    u      u  cc        u      -u    auga     u 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 21034176-21034272 [-]
intergenic
Database links

Mature sequence hsa-miR-649

Accession MIMAT0003319
Sequence

61 - 

aaaccuguguuguucaagaguc

 - 82

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).