Stem-loop sequence hsa-mir-643

AccessionMI0003658 (change log)
Symbol HGNC:MIR643
DescriptionHomo sapiens miR-643 stem-loop
Gene family MIPF0000488; mir-643
Literature search

1 open access papers mention hsa-mir-643
(1 sentences)

Stem-loop
   accaaguga      u                a        a   gg gu 
5'          uauuca ugucuaccugagcuag auacaagu guu  c  c
            |||||| |||||||||||||||| |||||||| |||  |  u
3'          guaagu auagauggacucgauc uauguuca cag  g  u
   ----aaaaa      u                g        -   -a ac 
Get sequence
Deep sequencing
8979 reads, 217 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 52281797-52281893 [+]
antisense
OTTHUMT00000466954 ; FPR1-004; intron 1
ENST00000594900 ; FPR1-004; intron 1
Database links

Mature sequence hsa-miR-643

Accession MIMAT0003313
Sequence

61 - 

acuuguaugcuagcucagguag

 - 82

Get sequence
Deep sequencing8716 reads, 96 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).