Stem-loop sequence hsa-mir-642a

AccessionMI0003657 (change log)
Previous IDshsa-mir-642
Symbol HGNC:MIR642A
DescriptionHomo sapiens miR-642a stem-loop
Gene family MIPF0000468; mir-642
Literature search

9 open access papers mention hsa-mir-642a
(55 sentences)

Stem-loop
   ------------au             g                      ggu 
5'               cugaguugggagg ucccucuccaaaugugucuugg   g
                 ||||||||||||| ||||||||||||||||||||||   g
3'               ggcucaacccucc agggagagguuuacacagaacu   g
   uuacuaccgucucc             a                      agg 
Get sequence
Deep sequencing
1669 reads, 0.752 reads per million, 133 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 45674928-45675024 [+]
sense
OTTHUMT00000457536 ; MARK4-010; intron 1
ENST00000587566 ; MARK4-010; intron 1
antisense
OTTHUMT00000457554 ; TRAPPC6A-002; intron 1
OTTHUMT00000457555 ; TRAPPC6A-003; intron 1
OTTHUMT00000457556 ; TRAPPC6A-001; intron 1
OTTHUMT00000457557 ; TRAPPC6A-004; intron 1
OTTHUMT00000457558 ; TRAPPC6A-005; intron 1
ENST00000006275 ; TRAPPC6A-002; intron 1
ENST00000588062 ; TRAPPC6A-003; intron 1
ENST00000585934 ; TRAPPC6A-001; intron 1
ENST00000592647 ; TRAPPC6A-004; intron 1
ENST00000587818 ; TRAPPC6A-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-642a
hsa-mir-642achr19: 45674928-45675024 [+]
hsa-mir-642bchr19: 45674932-45675008 [-]
Database links

Mature sequence hsa-miR-642a-5p

Accession MIMAT0003312
Previous IDshsa-miR-642;hsa-miR-642a
Sequence

16 - 

gucccucuccaaaugugucuug

 - 37

Get sequence
Deep sequencing678 reads, 101 experiments
Evidence experimental; RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-642a-3p

Accession MIMAT0020924
Sequence

51 - 

agacacauuuggagagggaacc

 - 72

Get sequence
Deep sequencing939 reads, 108 experiments
Evidence experimental; SOLiD [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:21767385 "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" Zaragosi LE, Wdziekonski B, Brigand KL, Villageois P, Mari B, Waldmann R, Dani C, Barbry P Genome Biol. 12:R64(2011).