Stem-loop sequence hsa-mir-633

AccessionMI0003648 (change log)
Symbol HGNC:MIR633
DescriptionHomo sapiens miR-633 stem-loop
Gene family MIPF0000546; mir-633
Literature search

4 open access papers mention hsa-mir-633
(10 sentences)

Stem-loop
   -aa    ucu    cucu    cuu     c              a   aaa 
5'    ccuc   uagc    guuu   uauug gguagauacuauua ccu   a
      ||||   ||||    ||||   ||||| |||||||||||||| |||   u
3'    ggag   guug    uaaa   auaac ccaucuaugauaau gga   g
   aua    --u    ---u    ---     a              c   aga 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 62944215-62944312 [+]
sense
OTTHUMT00000445717 ; RP11-583F2.3-001; intron 1
OTTHUMT00000445719 ; RP11-583F2.2-001; intron 1
ENST00000577423 ; SLC16A6P1-001; intron 1
ENST00000583416 ; RP11-583F2.2-001; intron 1
Database links

Mature sequence hsa-miR-633

Accession MIMAT0003303
Sequence

61 - 

cuaauaguaucuaccacaauaaa

 - 83

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).