Stem-loop sequence hsa-mir-631

AccessionMI0003645 (change log)
Symbol HGNC:MIR631
DescriptionHomo sapiens miR-631 stem-loop
Gene family MIPF0000508; mir-631
Literature search

5 open access papers mention hsa-mir-631
(14 sentences)

Stem-loop
   gu      cc    uaga      c   a  -      a 
5'   ggggag  uggu    ccuggc cag cc ucagcu c
     ||||||  ||||    |||||| ||| || |||||| a
3'   ccucuc  accg    ggacug guc gg agucga c
   --      ac    ---g      a   a  u      a 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 75353611-75353685 [-]
antisense
OTTHUMT00000421089 ; PPCDC-011; intron 2
ENST00000563298 ; PPCDC-011; intron 2
Database links

Mature sequence hsa-miR-631

Accession MIMAT0003300
Sequence

16 - 

agaccuggcccagaccucagc

 - 36

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).