Stem-loop sequence hsa-mir-623

AccessionMI0003637 (change log)
Symbol HGNC:MIR623
DescriptionHomo sapiens miR-623 stem-loop
Gene family MIPF0000798; mir-623
Literature search

3 open access papers mention hsa-mir-623
(101 sentences)

Stem-loop
   -guacaca     ag    ccu       gc       uu  a   ua     
5'         guaga  cauc   ugcaggg  uguuggg  gc ucc  agcu 
           |||||  ||||   |||||||  |||||||  || |||  ||| g
3'         cguuu  guag   augucuc  guagccc  cg agg  ucgu 
   gucuucca     cu    ---       au       uu  -   --     
Get sequence
Deep sequencing
19 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 99356131-99356228 [+]
antisense
OTTHUMT00000045560 ; SLC15A1-001; intron 17
ENST00000376503 ; SLC15A1-001; intron 17
Database links

Mature sequence hsa-miR-623

Accession MIMAT0003292
Sequence

16 - 

aucccuugcaggggcuguugggu

 - 38

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).